Skip to main content

Advertisement

Table 2 Gene-specific primers and PCR conditions for relative quantification in the Light Cycler system

From: Analysis of gene expression patterns by microarray hybridization in blood mononuclear cells of SLA-DRB1 defined Canadian Yorkshire pigs

Gene name GenBanka Primers (5'-> 3') b Prod. size (bp) c Ann. temp. (°C) d Acq. temp. (°C) e
TLR2 AB085935.1 F TGCGAATCCTGAAAATAGGC 343 59 84
   R CTTGCGTCAGTGATTTCTGC    
CCL4 NM_001075147 F GAAGCTCTGCGTGACTGTCC 391 59 87
   R AGGAACAGGATCTGCTGAGG    
IL1B NM_214055.1 F GCAGATGGTGTCTGTCATCG 444 60 84
   R TTCTCCATGTCCCTCTTTGG    
SLA-DQA AY191777.1 F TGTGGAGGTGAAGACATTGC 315 59 83
   R CAGCATCACTGGAGACTTGG    
CASP1 NM_214162.1 F GAGAAAATCTCACCGCTTCG 572 59 83
   R AGTCACTCTTTCGGCAGTGG    
RPL19 AV600389 F ATGAGACCAATGAAATCGCC 504 60 87
   R CATGAGGATCCGCTTGTTTT    
  1. a Sequenced used for primer design; b Sequence of forward (F) and reverse (R) primers in 5' to 3' orientation; c Size of the amplified PCR product; d Annealing temperature and e acquisition temperature for qPCR.