Skip to main content

Table 1 Analysis of the sequences flanking the alternative splice sites of the CHD7 CRA_e alternative transcript

From: Cloning and characterization of a novel alternatively spliced transcript of the human CHD7 putative helicase

Alternative

transcript

Donor splice

site location

(nt)a

Acceptor

splice site

location

(nt)a

Intron size

/kb

EXON/intron/EXON

(consensus splice sequence)b

5' CAG|guragu...cu/gac/u(y)10 15nyag|G) 3'

CHD7

CRA_e

Exon 3 (47)

Exon 36 (112)

81

5' CAG|gu uagu...c agau gugcuguuuuccuauuucag|A 3'

  1. a) Location of the exonics donor and acceptor splice sites of the CHD7 CRA_e alternative transcript. The numbers in parenthesis represent the exonic splicing sites at exons 3 and 36; b) The consensus sequence associated to splice donor, branch and acceptor sites according to Padgett [30] and Keller and Noon [31]. The vertical lines represent either 5' or 3' splice site and the putative branch point is underlined. The sequence of the investigated splice site in the CHD7 CRA_e transcript is represented below the consensus splice sequence. Nucleotides identity between the consensus and the investigated splice sites are shown in bold r = purine (A or G); y = pyrimidine (C or U)