Skip to main content

Table 2 Primer sets used to detect enteric bacteria

From: Bacteriological and physico-chemical assessment of wastewater in different region of Tunisia: impact on human health

Bacteria Primer Sequence Amplicon size (bp) Reference
Salmonell Hin 1750-L 5'- CTAGTGCAAATTGTGACCGCA-3' 236 Judy et al. 1993[25]
a   1751-R 5'- CCCCATCGCGCTACTGGTATC-3'   
  Hli 1788-L 5'- AGCCTCGGCTACTGGTCTTG- 3' 173 Judy et al. 1993[25]
   1789-R 5'- CCGCAGCAAGAGTCACCTCA3'   
Escherich ia coli est AL65 5'-TTAATAGCACCCGGTACAAGCAGG-3' 147 Hornes et al. 1991[21]
   AL125 5'CCTGACTCTTCAAAAGAGAAAATTAC-3'   
  elt LTL 5'-TCTCTATGTGCATACGGAGC-3' 322 Tamanai-Shacoori
   LTR 5'-CCATACTGATTGCCGCAAT-3'   et al. 1994[22]
  Stx VTcom-u 5'gACCgAAATAATTTATATgTg3' 518 Yamasaki et al. 1996[20]
   VTcom-d 5'TgATgATggCAATTCAgTAT3'   
  eae eae1 5'CTGAACGGCGATTACGCGAA 3' 917 Gunzburg et al. 1995[19]
   eae2 5'CCAGACGATACGATCCAG3'   
  bfpA BF1 5'AATggTgCTTgCgCTTgCTgC3' 326 Gunzburg et al. 1995[19]
   BF2 5'gCCgCTTTATCCAACCTggTA3'   
  ipaH ipaIII 5'gTTCCTTgACCgCCTTTCCgATACCgTC3' 619 Sethabutr et al. 1993[23]
   ipaIV 5'gCCggTCAgCCACCCTCTgAgAgTAC3'   
  aggR aggRks1 5'gTATACACAAAAgAAggAAgC3' 254 Ratchtrachenchai et al.
   aggRkas2 5'ACAgAATCgTCAgCATCAgC3'   1997[24]