Skip to main content
Figure 4 | BMC Research Notes

Figure 4

From: Simultaneous DNA and RNA isolation from brain punches for epigenetics

Figure 4

Analysis of gene transcription and methylation from stem cells and brain punches. (A) DNA and RNA were simultaneously extracted from PVN tissue punches of Bl6 mice. Bisulfite treated (Qiagen) DNA was amplified using bisulfite primers directed against a region of the mouse AVP gene enhancer [18]. The amplified products were then cloned in a pGEM vector (Promega) and 16 recombinant colonies sequenced using T7 primer. (B) RNA (100 ng) was reverse transcribed and then subjected to quantitative realtime PCR using primers against AVP cDNA [18]. AVP gene expression was correlated with methylation at individual CpGs revealing that methylation at CpG10 DNA negatively correlates with AVP expression (R2 = 0.8259). (C) Differentiated [+Lif] and undifferentiated [-Lif] mouse ES cells [19] were simultaneously extracted for RNA and DNA. RNA (100 ng) was reverse transcribed and then subjected to quantitative realtime PCR (Nanog F - agggtctgctactgagatgctctg, R - caaccactggtttttctgccaccg) and normalized to the expression of the housekeeping gene HPRT (F - acctctcgaagtgttggatacagg, R - cttgcgctcatcttaggctttg). (D) DNA (100 ng) from undifferentiated and differentiated cells was bisulfite treated and amplified using primers directed against the indicated regions of the mouse Nanog gene (4kb F - tttgtaggtgggattaattgtgaat, R - aaaaaaacaaaacaccaaccaaat; 1Kb F - ggaagattaggagtttgggattagt, R - atctaccaccatacccaatttaaaa; proximal promoter F - ggtagtttgttgggttttgtatttt, R - aactcttatctccccattcctaaac) and 16 recombinant colonies sequenced. Following differentiation the Nanog promotor becomes methylated and gene expression silenced.

Back to article page