Skip to main content

Table 3 Extension probes used for multiplex primer extension

From: Three multiplex snapshot assays for SNP genotyping in candidate innate immune genes

Gene Positionchange Variation Extension probe
(5’→3’)
Probe size (bp) PCR mix (μM)
Panel 1
IL1-α −889 C>T TTAATAATAGTAACCAGGCAACA 23 2.0
IL1-β −511 A>G TTTTTTTTTTGGTGCTGTTCTCTGCCTC 28 1.2
IL6 −174 C>G TTTTTTTTTTTTTTTCCCCTAGTTGTGTCTTGC 33 2.0
IL10 −592 A>C TTTTTTTTTTTTTTTTTTTTTCCTGTGACCCCGCCTGT 38 1.2
IL12 +705 A>G TTTTTTTTTTTTTTTTTTTTTTTTTTCCAGCTCCGACGACGGC 43 2.0
Panel 2
TLR2 +2259 A>G TTTTTTTGCGCTTCTGCAAGCTGC 24 0.8
IL10 −1082 A>G TTTTTTTTCACTACTAAGGCTTCTTTGGGA 30 0.8
TLR2 −16933 A>T TTTTTTTTTTTTTTTTTATTGAAGGGCTGCATCTGG 36 3.2
IL6 −596 A>G TTTTTTTTTTTTTTTTTTTTTGTAACTGCACGAAATTTGAGG 42 0.8
TLR4 +1196 C>T TTTTTTTTTTTTTTTTTTTTTTTTGTTCTCAAAGTGATTTTGGGACAA 48 3.2
Panel 3
IL12 +1196 C>G TTTTCAGGTGGCAAGGCCCC 20 1.0
TLR2 +2029 C>T TTTTTCCCTTCAAGTTGTGTCTTCATAAGC 30 1.4
TLR9 −1486 C>T TTTTTTTTTTTTTTCAGATAAAAGATCACTGCCCT 35 1.0
CD14 −260 A>G TTTTTTTTTTTTTTTTTTTTGGATGTTTCAGGGAGGGGGG 40 1.0
TLR4 +896 A>G TTTTTTTTTTTTTTTTTTTAGCATACTTAGACTACTACCTCGATG 45 1.0
CD14 −159 C>T TTTTTTTTTTTTTTTTTTTTTTTGAGGATTAATTAGTAACTCACCAGTTT 50 2.0