Skip to main content

Table 1 PCR primer sequences

From: Optimizing a PCR protocol for cpn60-based microbiome profiling of samples variously contaminated with host genomic DNA

Target Primer Sequence (5′–3′)a Annealing temp (°C) Reference
cpn60 UT H279 GAIIIIGCIGGIGAYGGIACIACIAC 42, 48, 54, 60 [15]
Pig α-actin gene JH0462 CCCAGAGCAAGCGAGGTATT 68 This study
  1. aI = inosine, Y = G or T, K = G or T, R = A or G, S = G or C.