Skip to main content

Table 2 Primers used in this study

From: Intronic sequences are required for AINTEGUMENTA-LIKE6 expression in Arabidopsis flowers

Primer name Sequence Purpose
AIL6-27 ATACGGTACCATGATGGCTCCGATGACGAACTGGTTAACGTTTTCTCTGTCACCAATGGAGATGTTGAGGTCATCTGA Cloning
AIL6-22 ATTGGGATCCTTAGTAAGACTGATTAGGCCAGAG Cloning
AIL6-31 AATAGGATCCAACCAATCATATAAGTTGATTGAG Cloning
AIL6-32 AAGAGGATCCTCGGCTAGGAAATA Cloning
AIL6Pro1 TAAAGTCTGCAGATAATATAGCATAGAATCATATAATATTT Cloning
AIL6Pro8 CTGCAGAAACTTTCTTATAAAAACAATTTTAC Cloning
AIL6-1 TTCGAGCTTTGGGATGTGAT Cloning
AIL6Pro5 TCTCTACTGCAACTTTTGTATC Cloning
AIL6-48 AATAGAATTCCCCGGGATGATGGCTCCGATGACGAAC Cloning
AIL6-50 AATACTGCAGGGATCCGTAAGACTGATTAGGCCAGAG Cloning
AIL6-52 AGTATTCGCGGCCGCGTATATATTTTCCATTCAGTTTTCG Cloning of I3F-AIL6m:GUS-3′
AIL6-53 CTTACGACGGCCGTCTGTTGATTTTAAGCAGAGCC Cloning of I3F-AIL6m:GUS-3′
AIL6-54 AGTATTCGCGGCCGCCTGTTGATTTTAAGCAGAGCC Cloning of I3R-AIL6m:GUS-3′
AIL6-55 CTTACGACGGCCGTGTATATATTTTCCATTCAGTTTTCG Cloning of I3R-AIL6m:GUS-3′
AIL6-56 AGTATTCGCGGCCGCGTACCCTTTTCTTTCTTCTTCTCT Cloning of I1F-AIL6m:GUS-3′
AIL6-57 CTTACGACGGCCGTCTTTGAAAAACAAAAACAAAAAACATCAT Cloning of I1F-AIL6m:GUS-3′
AIL6-58 AGTATTCGCGGCCGCCTTTGAAAAACAAAAACAAAAAACATCAT Cloning of I1R-AIL6m6m:GUS-3′
AIL6-59 CTTACGACGGCCGTGTACCCTTTTCTTTCTTCTTCTCT Cloning of I1R-AIL6m:GUS-3′
RTAIL6-8 GGGATAATAGCTGTAGGAGAGAAG RT-qPCR
RTAIL6-9 TCGAGCTGCCTTATCTTCTTTG RT-qPCR
RTFbox-1 TTTCGGCTGAGAGGTTCGAGT RT-qPCR
RTFbox-2 GATTCCAAGACGTAAAGCAGATCAA RT-qPCR
AIL6-FW2 AACTGGATCCTCGGAAGGACTCATCTTGCT Cloning
AIL6-RV2 AGGTGAATTCCCCTGAACGTTGGAGTTGTT Cloning