Skip to main content

Table 1 Characteristics of eight microsatellite loci developed and optimized from the chestnut-crested yuhina, Staphida everetti

From: Identification and characterization of microsatellite loci in two socially complex old world tropical babblers (Family Timaliidae)

Locus Repeat motif Primer sequence (5′–3′) TA (°C) Size range (bp) K H o H E HWE GenBank accession no.
StEv26 (CA)13 F: AGCAATAGGACTGACACAAGGT 61–57 84–96 7 0.90 0.70 0.43 KT582127
   R: AGTCTTGATTTCCCCACTTTGTC        
StEv103* (TAA)15 F: CCAGCCTCTGAACTGGTCTG 61–57 228–270 11 0.63 0.66 0.21 KT582120
   R: TTCTGTGGGTCTTGGTGGTT        
StEv106 (ATAG)10 F: TTGGACAAACAGCTGCTCCA 61–57 149–201 13 0.80 0.70 0.38 KT582121
   R: ACACACTTCAGCTGGAACTG        
StEv110* (AAAT)9 F: TCCAGCATTTCTTCCTCTTGGA 62–58 181–199 9 0.58 0.66 0.11 KT582122
   R: AACAGATCCACACAGGCAGG        
StEv112 (TTGG)11 F: AGAAGCAGAGAGAGGTAGGAA 61–57 234–258 11 0.89 0.72 0.11 KT582123
   R: TGAGAAAGGATGCACGTGTTG        
StEv114* (AT)8 F: TCCTTTTCTTTTCCTACTTTCATTTCT 61–57 164–180 6 1.00 0.64 <0.001 KT582124
   R: ACACAGCTTTGTGAGGGCTT        
StEv118 (GT)13 F: CACTGCCCAGTTTGGAATGC 61–57 120–152 11 0.84 0.81 0.35 KT582125
   R: CCAGCTCACACTCCTATGCC        
StEv122 (AC)10 F: AGTCCTCACTGTGCAGGTTG 61–57 244–252 5 0.74 0.64 0.13 KT582126
   R: ACATGCACACTGTGGACCAA        
  1. T A optimized touchdown upper and lower annealing temperatures, K number of alleles, H O , observed heterozygosity, H E expected heterozygosity, HWE test for Hardy–Weinberg equilibrium
  2. * Imperfect microsatellites