Skip to main content

Table 2 Characteristics of eight microsatellite loci in the grey-throated babbler, Stachyris nigriceps

From: Identification and characterization of microsatellite loci in two socially complex old world tropical babblers (Family Timaliidae)

Locus Repeat motif Primer sequence (5′–3′) TA (°C) Size range (bp) K Ho HE HWE GenBank accession no.
StNi102 (TG)13 F: TGAAGAATGTGGGTGGAGAAGT 58 171–179 5 0.71 0.65 1.00 KT592540
   R: GTTTCTTGCTTTAGATGGGCTCCTGC        
StNi104 (TAT)16 F: TCTGTCTGTGTTGGGGTTTATGT 58 148–194 15 0.81 0.82 0.53 KT592541
   R: GTTTCTGACCTCACATGCCAAGACCA        
StNi105* (ACAG)10 F: TGGCAAACACACGTCAGTCT 58 156–188 8 0.57 0.55 0.47 KT592542
   R: GTTTCTCTCAACAAGGGCTCGAGGTT        
StNi107 (ATA)14 F: TCACATGTATAAGTTCCACAGTGA 58 179–250 21 0.90 0.87 0.56 KT592543
   R: GTTTCTACTCCAAACAGAACTACAGAGCT        
StNi111 (TCAA)11 F: AGCACGTTTACTCCAAACCA 58 208–200 4 0.80 0.70 0.36 KT592544
   R: GTTTCTGGTTTCAGCTTTGGTCCTTCC        
StNi112 (GTTT)7 F: TTTTGGAGGGTTGGCACAGT 58 211–237 12 0.67 0.67 0.81 KT592545
   R: GTTTCTTTGCCCAGTCCTTTGCTGAA        
StNi114* (TTTG)7 F: AGAGGCTAGCTTGCTAAGGA 58 187–199 8 0.14 0.14 1.00 KT592546
   R: GTTTCTTGGTCTCATCAGTCGGCCTA        
StNi130 (TG)10 F: CTCTCCCTCCTCTCCGCC 58 200–246 8 0.53 0.50 0.71 KT592547
   R: GTTTCTTTTGCTGGAGCCTAAGACCC        
  1. The pigtail sequence GTTTCT was added to the 5′ end of the reverse primer
  2. T A optimized annealing temperature, K number of alleles, H O observed heterozygosity, H E expected heterozygosity, HWE test for Hardy–Weinberg equilibrium
  3. * Imperfect microsatellites