Skip to main content

Table 1 Mean and standard deviation of nanostring counts of candidate housekeeping miRNAs in order of decreasing average counts

From: Identification of reference miRNAs in plasma useful for the study of oestrogen-responsive miRNAs associated with acquired Protein S deficiency in pregnancy

Candidate housekeeping miRNA miRBase accession number Mature miRNA sequence TaqMan assay ID Nanostring raw counts
Male Non-pregnant Oral contraceptive Pregnant
n = 4 n = 4 n = 4 n = 4
Age: 37 ± 14 Age: 34 ± 15 Age: 30 ± 3 Age: 29 ± 5
miR-25-3p MIMAT0000081 CAUUGCACUUGUCUCGGUCUGA 000403 232 ± 64 211 ± 22 225 ± 31 278 ± 77
miR-520f MIMAT0002830 AAGUGCUUCCUUUUAGAGGGUU 001120 109 ± 25 101 ± 16 125 ± 33 89 ± 5
miR-149-5p MIMAT0000450 UCUGGCUCCGUGUCUUCACUCCC 002255 85 ± 13 82 ± 16 80 ± 6 72 ± 13
let-7a-5p MIMAT0000067 UGAGGUAGUAGAUUGUAUAGUU 000377 76 ± 17 87 ± 15 79 ± 32 80 ± 16
miR-2682-5p MIMAT0013517 CAGGCAGUGACUGUUCAGACGUC 463610_mat 74 ± 8 71 ± 10 74 ± 14 75 ± 2
miR-612 MIMAT0003280 GCUGGGCAGGGCUUCUGAGCUCCUU 001579 61 ± 9 70 ± 9 70 ± 9 60 ± 11
miR-222-3p MIMAT0000279 AGCUACAUCUGGCUACUGGGU 002276 51 ± 15 52 ± 7 62 ± 9 53 ± 4
miR-598 MIMAT0003266 UACGUCAUCGUUGUCAUCGUCA 001988 46 ± 10 62 ± 3 60 ± 11 58 ± 8
miR-188-5p MIMAT0000457 CAUCCCUUGCAUGGUGGAGGG 002320 50 ± 8 61 ± 2 48 ± 12 55 ± 3
miR-489 MIMAT0002805 GUGACAUCACAUAUACGGCAGC 002358 49 ± 16 55 ± 12 49 ± 12 46 ± 8
miR-1183 MIMAT0005828 CACUGUAGGUGAUGGUGAGAGUGGGCA 002841 46 ± 6 58 ± 4 54 ± 18 41 ± 12