Skip to content

Advertisement

Open Access

Identification of 24 new microsatellite loci in the sweat bee Lasioglossum malachurum (Hymenoptera: Halictidae)

  • Paul J. Parsons1, 2Email author,
  • Christelle Couchoux1,
  • Gavin J. Horsburgh2,
  • Deborah A. Dawson2 and
  • Jeremy Field1
BMC Research Notes201710:753

https://doi.org/10.1186/s13104-017-3089-4

Received: 24 August 2017

Accepted: 13 December 2017

Published: 19 December 2017

Abstract

Objective

The objective here is to identify highly polymorphic microsatellite loci for the Palaearctic sweat bee Lasioglossum malachurum. Sweat bees (Hymenoptera: Halictidae) are widespread pollinators that exhibit an unusually large range of social behaviours from non-social, where each female nests alone, to eusocial, where a single queen reproduces while the other members of the colony help to rear her offspring. They thus represent excellent models for understanding social evolution.

Results

24 new microsatellite loci were successfully optimized. When amplified across 23–40 unrelated females, the number of alleles per locus ranged from 3 to 17 and the observed heterozygosities 0.45 to 0.95. Only one locus showed evidence of significant deviation from Hardy–Weinberg equilibrium. No evidence of linkage disequilibrium was found. These 24 loci will enable researchers to gain greater understanding of colony relationships within this species, an important model for the study of eusociality. Furthermore, 22 of the same loci were also successfully amplified in L. calceatum, suggesting that these loci may be useful for investigating the ecology and evolution of sweat bees in general.

Keywords

HalictidaeMicrosatellite Lasioglossum malachurum Lasioglossum calceatum Sweat bee

Introduction

Sweat bees (Hymenoptera: Halictidae) are widespread pollinators which exhibit an unusually large range of social behaviours from non-social, where each female nests alone, to eusocial, where a single queen reproduces while the other members of the colony help to rear her offspring [1]. Sweat bees are also unusual in that social and non-social species are often closely related, with multiple evolutionary transitions having occurred between sociality and non-sociality [2]. Sweat bees thus represent excellent models for understanding social evolution [1, 2]. Here we present a new set of microsatellite loci developed from Lasioglossum malachurum (Kirby, 1802), a haplodiploid eusocial species that has been particularly well studied, mainly because it is widely distributed in the Western Palaearctic and because it often occurs in large, dense nesting aggregations that facilitate behavioural research [36]. Microsatellite markers are widely used in social evolution research, for example to investigate population structure, estimate genetic relatedness and assign offspring to parents [79]. Microsatellite loci have been developed for this species previously [3, 10] but most of them have comparatively low heterozygosities and are difficult to combine into multiplex reactions because of highly specific annealing temperatures and polymerase chain reaction (PCR) mixes. Here, we report 24 new microsatellite markers developed for L. malachurum, 14 of which have been efficiently amplified in two multiplex sets. These markers should substantially aid future studies on sweat bee behaviour and ecology.

Main text

Lasioglossum malachurum females were sampled from a field site at Denton in East Sussex, UK in 2015. Genomic DNA was extracted from head, abdomen and/or legs using an ammonium acetate extraction method [11, 12]. DNA concentration was quantified using a Fluostar Optima fluorimeter and its quality assessed using gel electrophoresis. DNA from one foundress (female M4) from Denton was digested using MboI and the fragments enriched for dinucleotide and tetranucleotide repeat motifs (following [13]). An Illumina paired end library was then compiled using this repeat-enriched genomic DNA. The NEBNext Ultra library preparation kit (New England Biolabs Inc. Cat. No. E7370S) protocol was followed and DNA sequencing was conducted using a MiSeq Benchtop Sequencer (Illumina). Primer sets were designed from 53 microsatellite sequences using PRIMER3 v0.4.0 [14]. Sequences were confirmed to be unique using BLAST software [15].

Each 2 µl PCR contained approximately 10 ng of air-dried genomic DNA, 0.2 µM of each primer and 1 µl QIAGEN Multiplex PCR mix (QIAGEN Inc. Cat. No. 20614) following [16]. As we required loci that could be reliably multiplexed together for efficient use we designed primers with very similar melting temperatures (± 2 °C) enabling these to be amplified at the same annealing temperature (57 °C). The following PCR profile was used: 95 °C for 15 min, followed by 44 cycles of 94 °C for 30 s, 57 °C for 90 s, 72 °C for 90 s and finally 60 °C for 30 min. PCR amplification was performed using a DNA Engine Tetrad ®Thermal Cycler (MJ Research, Bio-Rad, Hemel Hempstead, Herts, UK). PCR products were genotyped on an ABI 3730 48-well capillary DNA Analyser using the LIZ size standard (Applied Biosystems Inc. Cat. No. 4322682). Alleles were scored using GENEMAPPERv3.7 software (Applied Biosystems Inc.). Of the 53 markers, 24 could be scored reliably across the test sample (23–40 females all from the same field site at Denton) (Table 1). The remaining 29 were found to be either monomorphic or unreliable following our PCR methodology (Table 2). It is possible that with more specific optimization, some of these could be used in future studies. We successfully incorporated 14 of the optimized markers into two multiplex panels (using the above PCR reagents and concentrations) with no dropout or artifacts produced (Table 1).
Table 1

Characterisation of 24 new L. malachurum microsatellites

Locus name

GenBank sequence accession number

Panel and dye

Repeat motif

Primer sequence (5′–3′)

Na tested

N alleles

Expected allele sizeb, size range

HObs

HExp

HWE p value

Est. F (null)

L. cal successc

Lma02

MG273262

1

(TC)13

F: CCGAGTTCATCAACATCCTC

23

10

150

0.87

0.83

0.712

− 0.037

P

  

NED

R: TTGATTATCAGCGAGATGAGC

  

139–185

     

Lma03

MG273263

1

(AG)14

F: AAAGCGTTGCGAGACACC

38

7

154

0.816

0.745

0.103

− 0.063

P

  

PET

R: AGCATAATGGAAACCCAACG

  

137–167

     

Lma04

MG273264

 

(TG)12

F: CGTTACCGCGTTGGTTTC

37

6

169

0.649

0.727

0.162

0.034

M

   

R: GTCTTGTCTAACCGCAACAGC

  

165–177

     

Lma12

MG273265

2

(CT)12

F: CCAACCGAACACCAACTTTC

39

10

150

0.667

0.701

0.413

0.017

P

  

PET

R: CTCCCGGGTTGTCATGTAAG

  

131–181

     

Lma14

MG273266

1

(AG)14

F: CAACGCGTGACAGGTGATAC

40

14

170

0.825

0.896

0.186

0.035

P

  

6-FAM

R: CGGCTACGTTCCACTATGAAG

  

162–192

     

Lma20

MG273267

 

(AG)19

F: AGCGCTCGATGACTGTCG

39

17

210

0.872

0.889

0.087

0.007

F

   

R: TTGCGCAAGCCGTTCTAC

  

196–262

     

Lma21

MG273268

2

(GA)16

F: CGGTAAACTTGCTTCGACCTG

38

11

137

0.868

0.85

0.053

− 0.026

F

  

NED

R: CCGATTCCTTCACAGACACG

  

135–156

     

Lma23

MG273269

 

(GA)13

F: GATAATCAATGGTAATCGGTTGG

40

11

167

0.85

0.838

0.179

− 0.017

M

   

R: TTAACATCGTTCGCTTCTCG

  

154–218

     

Lma24

MG273270

2

(GA)13 CA (GA)6

F: TCCTCGGACAAGGAGATACG

40

13

172

0.925

0.891

0.723

− 0.026

P

  

6-FAM

R: TTCGGGTACCGTTCAGTCTC

  

141–181

     

Lma27

MG273271

 

(GA)13

F: GCTGGCAGCTCTGGAGAAG

38

9

189

0.737

0.804

0.071

0.032

P

   

R: TGACGGCCATTTAGTTCGTC

  

177–199

     

Lma29

MG273272

1

(CT)4 TT (CT)9

F: CTCGTCCCTCGTGTGACTC

38

12

204

0.868

0.883

0.725

0.003

P

  

PET

R: GTATCGTGCGTGCGTGTC

  

201–231

     

Lma30

MG273273

 

(GACGA)6

F: TCCGTCTCTGGTCGATACTG

38

3

237

0.447

0.407

0.854

− 0.075

P

   

R: ACAGCAGCATCTGAACTTGC

  

225–235

     

Lma31

MG273274

 

(TCTT)10

F: CGCACTCCGCTTTTCCTC

40

6

146

0.55

0.664

0.049

0.084

P

   

R: CGTCACCAGGAGAGCAAGG

  

142–164

     

Lma34

MG273275

 

(CT)12

F: TCTGAACAGTACGGAACAATGC

40

6

176

0.675

0.684

0.718

− 0.009

P

   

R: ACCGACACGGGAGAGAGAG

  

165–179

     

Lma36

MG273285

1

(CT)16

F: GGCCCTTCGACTTTGTTG

38

8

188

0.737

0.785

0.298

0.027

P

  

VIC

R: GAATCTCTGGGTGCTCTAACG

  

185–199

     

Lma39

MG273276

2

(CTAT)8

F: CGAGCCTATGCAGAGAACAG

38

7

205

0.789

0.75

0.68

− 0.034

P

  

PET

R: TGGATGGCTGCTGAGTAAAC

  

205–237

     

Lma40

MG273277

2

(GA)12

F: CGTTCGTTCGTTCGTTACTG

38

14

150

0.947

0.906

0.74

− 0.029

P

  

VIC

R: CAGAGTGCGTCGCTTGTTAG

  

155–189

     

Lma42

MG273278

 

(AG)13

F: ACCATCGCCCTTCCACTAC

40

5

167

0.75

0.733

0.623

− 0.016

P

   

R: CCGAAACTATTCGCCCATC

  

161–169

     

Lma48

MG273279

2

(TC)14

F: GTTGGATGCATCTGGAGGAC

38

6

206

0.763

0.722

0.14

− 0.043

M

  

NED

R: TGCGGTGGTTATTGATTTCC

  

193–209

     

Lma49

MG273280

 

(GAAA)10

F: GAGAGGGTGGTTGCACTACG

38

4

209

0.684

0.62

0.786

− 0.055

M

   

R: CTCGTGGAATCGAACTCACC

  

189–209

     

Lma50

MG273281

 

(CT)3 CG (CT)12

F: CGTTTAACCGGCTCGCTAC

38

8

181

0.684

0.763

0.726

0.051

P

   

R: CCGCGAATAAGTGGAGTGTC

  

163–209

     

Lma51

MG273282

1

(CT)11

F: GAGAAATTGCCAGCAAACATC

40

4

243

0.475

0.545

0.259

0.066

P

  

6-FAM

R: AGTTTCGTGGAAGGGAACG

  

237–243

     

Lma52

MG273283

1

(TG)11

F: CGGCAACTGCTTGCATAAC

40

5

156

0.8

0.732

0.575

− 0.056

M

  

VIC

R: CCCGTAGCACTCGCATACTC

  

151–159

     

Lma53

MG273284

1

(AC)12

F: ACGCGGGATTACTTTCAATC

40

9

228

0.675

0.759

0.053

0.057

P

  

NED

R: CCAATTATCGGGTGAAGGAG

  

217–241

     

aN: number of diploid, unrelated L. malachurum females genotyped (all from the same population at Denton)

bBased on the sequenced individual (sample M4); Hobs and HExp: observed and expected heterozygosities; HWE: p value when testing for deviation from Hardy–Weinberg equilibrium; F(Null): Estimated frequency of null alleles

cAmplification success across 14 L. calceatum individuals: F failed to amplify, M monomorphic, p polymorphic

Table 2

Identification of a further 29 markers that were rejected and not considered for multiplex panels

Locus name

GenBank sequence accession number

Repeat motif

Primer sequence

Expected allele size

Reason for dropping (tested in 23–24 individuals)

Lma01

MG273287

(TGAC)7

F: AACGCCTCGGTGAACCTG

108

Monomorphic

   

R: TCGAGTTCTCCCTCCTCGTATC

  

Lma05

MG273288

(TTTC)7

F: ATGCGTCTAAATCGTTCCTG

178

Monomorphic

   

R: AACAAAGAATGAACGAACGTG

  

Lma06

MG273289

(AG)11

F: CGGGAACGACGGAGAGAG

184

False peaks

   

R: ACGGGTCTGTTCACCCTTTG

  

Lma07

MG273286

(GAAA)5

F: GTCATGGAGAGGGTGGTTG

189

No product

   

R: CAATCTCAACCGTGTTCGTC

  

Lma08

MG273290

(TTCT)7

F: CTATCCGAGGCCTGTACACTG

192

No product

   

R: ATCTGAAATCGTGGCTGGTC

  

Lma09

MG273291

(AGAA)5

F: ACGGGACTGAAAGGGACAC

201

Monomorphic

   

R: TACTTCGCGTGCCTGTCTC

  

Lma10

MG273292

(AAAG)7

F: GAGACAACGAGGGAGAAAGC

206

Stutter

   

R: AACCTCAACCGTGTTCGTC

  

Lma11

MG273293

(GA)7

F: CTTGTACCACGCGTACACACC

111

False peaks

   

R: GCCCTGCGTCTTCTCCTC

  

Lma13

MG273294

(CT)18

F: GCTCATCGAGGACGAGGTG

154

False peaks

   

R: GCGGTTGGCTGTCATAAGTG

  

Lma15

MG273295

(TGCT)5

F: GGACAGTCCGACGAAGGAG

179

No product

   

R: GCTTCATCCCTTTACTCCATAGC

  

Lma16

MG273296

(TC)20

F: ACATTGTTCACCGGACAAATC

187

Monomorphic

   

R: CGTCGAGGATAAGGTTACGG

  

Lma17

MG273297

(TC)11

F: GTCAACGGTAATCCGAGGTG

189

False peaks/Stutter

   

R: TGATACACCGGGAACCATTC

 

Lma18

MG273298

(AG)16

F: GGGATACTAGACAGCCGGAATATAG

193

False peaks

   

R: GAATGAACCACGCCGAAG

  

Lma19

MG273299

(TC)20

F: TGTAAACGGCCGAAGTGTC

203

False peaks/Stutter

   

R: ACAATGTGTGTTCCGGTCAG

 

Lma22

MG273300

(TCTT)5

F: GCCGGACCAGATTAAATGC

151

No product

   

R: AAAGACGAGGCTCAAAGAAGC

  

Lma25

MG273301

(CTAT)6

F: CGAAATACCGTTAACCAACATC

180

Monomorphic

   

R: TAAAGTGGCGAGTGATGGAC

  

Lma26

MG273302

(AG)16

F: CTTCGATTCCTCGGGTCAC

188

No product

   

R: TTCCGGCACGTTTATGTAGC

  

Lma28

MG273303

(CT)17

F: ATTCGCGACAATGAACGAG

193

False peaks

   

R: CAAACGCGAGTCAATAAATCC

  

Lma32

MG273304

(TC)16

F: CGACGTACCTCTGCTTCCTC

152

Stutter

   

R: AGGTCACTTAAATGGTGGTTGG

  

Lma33

MG273305

(GA)19

F: CTCTTCTCGATTCCGTCTGG

167

False peaks

   

R: TTTCGGCTCTTTGCTCTCTC

  

Lma35

MG273306

(GAGT)5

F: CCTTCGAGAGGTCAGAGCTAAAG

181

No product

   

R: CACGTGGCACCACAAATTC

  

Lma37

MG273307

(TTCT)5

F: GTGGCCTATGCTCCTCTCC

190

Monomorphic

   

R: ATCTGAAATCGTGGCTGGTC

  

Lma38

MG273308

(GACA)9

F: AGAGACAAAGGCGGAGACAG

197

False peaks/Stutter

   

R: TATCTGCGAGACCGACGA

 

Lma41

MG273309

(TC)20

F: AATGATTGTGAACAGTTTGGTATG

152

Stutter

   

R: CGAGACTGCAAGAAGTTTCAC

  

Lma43

MG273310

(AG)17

F: TTCAGCCGAGGGTAGCAC

178

False peaks

   

R: CGTACCATCATCTCGTGTCG

  

Lma44

MG273311

(AG)15

F: ATGAGACTGGCACGACTGTG

182

False peaks

   

R: ATGCGTCGCTCCCTTAATC

  

Lma45

MG273312

(CT)15

F: TTTCGCATCCATCTTCCTTC

189

False peaks/Stutter

   

R: CGCGAATTTCGGTATCTTTC

 

Lma46

MG273313

(TCCT)5

F: TCCCTTTACCTTCCTTTCTCG

190

Monomorphic

   

R: TGCAACATTTGTACCGAACAG

  

Lma47

MG273314

(CTTT)5

F: CTATCCGAGGCCTGTACACTG

197

Stutter

   

R: GGGTAAGCAAGCATCGTTTC

  

 Based on the sequenced individual (sample M4)

The numbers of alleles and heterozygosities were calculated for each of the 24 loci using CERVUS v3.0.6 and with the sample sizes shown in Table 1 [17]. Tests for deviation from Hardy–Weinberg equilibrium (HWE) and linkage disequilibrium (LD) were conducted using GENEPOP web version 4.2 [18]. To correct p-values in multiple tests, the Q Value was applied to LD p-values. The q value is a measure of the significance in terms of false discovery rate, rather than conventional Bonferroni correction which attempts to measure significance in terms of false positives only [19]. Observed levels of heterozygosity ranged from 0.45 to 0.95 with 3–17 alleles per locus (Table 1). Only Lma31 deviated from HWE (p = 0.049). No groups of loci displayed LD, providing no evidence of physical linkage based on the individuals genotyped.

These loci are likely to be useful for investigating the ecology and behaviour of L. malachurum and also potentially that of other sweat bees. Indeed, we have successfully amplified 22 of the 24 loci in L. calceatum (Scopoli) individuals sampled in the UK; only Lma20 and Lma21 failed to amplify and 17 of the 22 loci that did amplify were polymorphic (Table 1; Davison & Field, in prep.).

Limitations

Due to the relatively short read length of the MiSeq Benchtop Sequencing system we were unable to design primer sets to amplify greater than 300 bases. This may however be somewhat fortuitous; the incorporation of larger markers into multiplex panels often proves problematic, since they are generally harder to amplify than markers with smaller products and are more susceptible to dropout [20].

Abbreviations

HWE: 

Hardy–Weinberg equilibrium

LD: 

linkage disequilibrium

PCR: 

polymerase chain reaction

Declarations

Authors’ contributions

PP: Tested and optimised the primers, scored loci, performed the analysis, co-wrote the paper. CC: Collected samples, scored loci and assisted with the analysis. GJH: prepared the MiSeq library and designed primer sets. DAD: Assisted with marker development, primer design, analysis and manuscript preparation. JF: Wrote the grant application, collected samples and co-wrote the paper. All authors read and approved the final manuscript.

Acknowledgements

We thank Paul Davison for assisting with sample collection and the NERC Biomolecular Analysis Facility—Sheffield, UK for their facilities.

Competing interests

The authors declare that they have no competing interests.

Availability of data and materials

The sequences acquired herein have been submitted to Genbank, Accession Numbers MG273262–MG273314.

Consent for publication

Not applicable

Ethics approval and consent to participate

Not applicable

Funding

This work was funded by the UK Natural Environment Research Council (NERC Grant NE/M003191/1 to J.F.). This project has also received funding from the European Research Council (ERC) under the European Union’s Horizon 2020 research and innovation programme (Grant Agreement No. 695744 to JF).

Publisher’s Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Open AccessThis article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.

Authors’ Affiliations

(1)
Centre for Ecology and Conservation, University of Exeter, Penryn Campus, Cornwall, UK
(2)
NERC Biomolecular Analysis Facility, Department of Animal and Plant Sciences, University of Sheffield, Sheffield, UK

References

  1. Schwarz MP, Richards MH, Danforth BN. Changing paradigms in insect social evolution: insights from halictine and allodapine bees. Annu Rev Entomol. 2007;52:127–50.View ArticlePubMedGoogle Scholar
  2. Danforth BN. Evolution of sociality in a primitively eusocial lineage of bees. Proc Natl Acad Sci USA. 2002;99:286–90.View ArticlePubMedGoogle Scholar
  3. Paxton RJ, Arevalo E, Field J. Microsatellite loci for the eusocial Lasioglossum malachurum and other sweat bees (Hymenoptera, Halictidae). Mol Ecol Notes. 2003;3:82–4.View ArticleGoogle Scholar
  4. Strohm E, Bordon-Hauser A. Advantages and disadvantages of large colony size in a halictid bee: the queen’s perspective. Behav Ecol. 2003;14:546–53.View ArticleGoogle Scholar
  5. Wyman LM, Richards MH. Colony social organization of Lasioglossum malachurum Kirby (Hymenoptera, Halictidae) in southern Greece. Insect Soc. 2003;50:201–11.View ArticleGoogle Scholar
  6. Zobel MU, Paxton RJ. Is big the best? Queen size, usurpation and nest closure in a primitively eusocial sweat bee (Lasioglossum malachurum). Behav Ecol Sociobiol. 2007;61:435–47.View ArticleGoogle Scholar
  7. Paxton RJ, Ayasse M, Field J, Soro A. Complex sociogenetic organization and reproductive skew in a primitively eusocial sweat bee, Lasioglossum malachurum, as revealed by microsatellites. Mol Ecol. 2002;11:2405–16.View ArticlePubMedGoogle Scholar
  8. Field J, Paxton RJ, Soro A, Bridge C. Cryptic plasticity underlies a major evolutionary transition. Curr Biol. 2010;20:2028–31.View ArticlePubMedGoogle Scholar
  9. Soro A, Field J, Bridge C, Cardinal SC, Paxton RJ. Genetic differentiation across the social transition in a socially polymorphic sweat bee, Halictus rubicundus. Mol Ecol. 2010;19:3351–63.View ArticlePubMedGoogle Scholar
  10. Soro A, Ayasse M, Zobel MU, Paxton RJ. Complex sociogenetic organization and the origin of unrelated workers in a eusocial sweat bee, Lasioglossum malachurum. Insect Soc. 2009;56:55–63.View ArticleGoogle Scholar
  11. Nicholls JA, Double MC, Rowell DM, Magrath RD. The evolution of cooperative and pair breeding in thornbills Acanthiza (Pardalotidae). J Avian Biol. 2000;31:165–76.View ArticleGoogle Scholar
  12. Richardson DS, Jury FL, Blaakmeer K, Komdeur J, Burke T. Parentage assignment and extra-group paternity in a cooperative breeder: the Seychelles warbler (Acrocephalus sechellensis). Mol Ecol. 2001;10:2263–73.View ArticlePubMedGoogle Scholar
  13. Armour JAL, Neumann R, Gobert S, Jeffreys AJ. Isolation of human simple repeat loci by hybridization selection. Hum Mol Gen. 1994;3:599–605.View ArticlePubMedGoogle Scholar
  14. Rozen S, Skaletsky HJ. PRIMER version 3 on the WWW for general users and for biologist programmers. In: Krawetz S, Misener S, editors. Bioinformatics methods and protocols: methods in molecular biology. New Jersey: Humana Press; 2000. p. 365–86.Google Scholar
  15. Altschul SF, Madden TL, Schäffer AA, Zhang J, Zhang Z, Miller W, et al. Gapped BLAST and psi–BLAST: a new generation of protein database search programs. Nucleic Acids Res. 1997;25:3389–402.View ArticlePubMedPubMed CentralGoogle Scholar
  16. Kenta T, Gratten J, Haigh NS, Hinten GN, Slate J, Butlin RK, et al. Multiplex SNP-SCALE:a cost-effective medium-throughput single nucleotide polymorphism genotyping method. Mol Ecol Res. 2008;8:1230–8.View ArticleGoogle Scholar
  17. Kalinowski ST, Taper ML, Marshall TC. Revising how the computer program CERVUS accommodates genotyping error increases success in paternity assignment. Mol Ecol. 2007;16:1099–106.View ArticlePubMedGoogle Scholar
  18. Rousset F. Genepop’007: a complete reimplementation of the Genepop software for Windows and Linux. Mol Ecol Res. 2008;8:103–10.View ArticleGoogle Scholar
  19. Storey J. A direct approach to false discovery rates. J R Stat Soc Series B Stat Methodol. 2002;64:479–98.View ArticleGoogle Scholar
  20. Toouli CD, Turner DR, Grist SA, Morley AA. The effect of cycle number and target size on polymerase chain reaction amplification of polymorphic repetitive sequences. Anal Biochem. 2000;280:324–6.View ArticlePubMedGoogle Scholar

Copyright

© The Author(s) 2017

Advertisement