Skip to main content

Table 1 Sequence of primers used in PCR assays

From: Some coagulase negative Staphylococcus spp. isolated from buffalo can be misidentified as Staphylococcus aureus by phenotypic and Sa442 PCR methods

“Gene” Primer Sequence (5′–3′) Product (bp) Reference
coa Forward GTCTTGAAAGTAGCTCATCTAAACTTG 228 This study
Reverse ATCCAAATGTTCCATCGTTGTATTC
cyd-aureus Forward CCCATTTGCTTGGTCTGTAGTA 432 This study
Reverse GTCCAGCCCATTTCTGGATTA
Sa442 Forward AATCTTTGTCGGTACACGATATTCTTCACG 108 Martineau et al. [4]
Reverse CGTAATGAGATTTCAGTAGATAATACAACA