Skip to content

Advertisement

  • Research note
  • Open Access

Distribution of resistance genes encoding ESBLs in Enterobacteriaceae isolated from biological samples in health centers in Ouagadougou, Burkina Faso

  • 1, 2Email author,
  • 5,
  • 1,
  • 2, 6,
  • 4,
  • 1,
  • 3,
  • 1 and
  • 4
BMC Research Notes201811:471

https://doi.org/10.1186/s13104-018-3581-5

  • Received: 1 June 2018
  • Accepted: 6 July 2018
  • Published:

Abstract

Objective

Resistance to antibiotics most especially third generation cephalosporins has assumed a worrisome dimension globally. Genes conferring these resistance which are mediated by enzymes known as extended spectrum beta-lactamases (ESBLs) are now wide spread among several Enterobacteriaceae species. However there is paucity of data regarding the distribution of these genes in Burkina Faso. Hence this prospective study aims to determine the prevalence and distribution of ESBL encoding genes in ESBL producing Enterobacteriaceae strains isolated from clinical samples of patients attending the three major hospitals in Ouagadougou Burkina Faso.

Results

ESBL-encoding genes were assayed in 187 ESBL producing Enterobacteriaceae strains. Among these isolates, the prevalence of ESBL-producing strains with blaTEM, blaSHV and blaCTX-M genes were 26.2% (49/187), 5.9% (11/187) and 40.1% (75/187) respectively. The association of ESBL encoding genes with health centers was statistically significant (p = 0.0209). Approximately 39.6% of E. coli harbored CTX-M and Klebsiella spp. 5.9%. This study demonstrates the dissemination of TEM, SHV and CTX-M genes in ESBL producing Enterobacteriaceae strains in Ouagadougou. Continuous spread of these bacteria poses great public health risk, thus increased surveillance and regulation of antibiotics use is imperative in Burkina Faso.

Keywords

  • Extended spectrum beta-lactamase
  • bla-TEM
  • bla-SHV
  • bla-CTX-M
  • Burkina Faso

Introduction

The problem of microbial drug resistance has assumed a global dimension and an alarming magnitude, being one of the leading unresolved problems in public health [1]. Beta-lactam antibiotics (penicillins, cephalosporins, monobactams and carbapenems) are among the most prescribed drugs in the world [2]. Their use is followed by resistance observed in several Enterobacteriaceae species [3]. Mechanism of resistance includes: topoisomerase mutation by reducing antibiotic affinity, activation of efflux system which expels antibiotics out of the cell and antibiotic inactivation by enzymes [4, 5]. A key mechanism of note is the production of β-lactamase that hydrolyzes the β-lactam ring [6, 7]. Broad spectrum beta-lactamases are enzymes that have the particularity to hydrolyze all beta-lactams including third-generation cephalosporins except cephamycins and carbapenems [8, 9]. The number of extended-spectrum beta-lactamases producing Enterobacteriaceae isolates (ESBL) has been on the increase in recent times worldwide [10]. Several antibiotic resistance genes studies have been carried out in Burkina Faso [1114], but they are all restricted to single health centers in Ouagadougou city. Hence the aim of this study is to determine the prevalence and distribution of resistance genes coding for broad spectrum beta-lactamases in the three major health centers of Ouagadougou, Burkina Faso. Since hospitals in recent years has been considered as reservoirs of ESBL producing Enterobacteriaceae [15].

Main text

Bacterial strains consisted of isolates obtained from our previous report [16]. They were obtained from patients attending three major hospitals Yalgado Ouedraogo Teaching Hospital (CHU-YO), Charles De Gaulle Paediatric Teaching Hospital (CHUP-CDG) and Saint Camille Hospital (HOSCO) in Ouagadougou Burkina Faso. Isolates were obtained from urine samples, pus samples, blood samples, stool samples, vaginal swab samples and pleural fluid samples.

Methodology

Genomic DNA was extracted according to Guedda et al. [17] with slight modification. One to five bacterial colonies were suspended in 100 ml of nuclease free water and suspension was heated at 100 °C for 10 min. After centrifugation at 12,000×g for 10 min at 4 °C, 5 µL of supernatant were used as template in a 50 µL PCR reaction [18]. Resistance genes blaTEM, blaCTX-M, blaSHV were detected by PCR. PCR was performed in a final volume of 50 μL using the set of primers shown in Table 1. The reaction mix consist of 5× colored buffer 5 μL and 5× unshaded buffer, 3 μL of MgCl2 (25 mM) (Promega, USA), 0.5 μL of dNTP (10 mM), 0.5 μL of each primer (20 mM) (Sigma Genesys) and 0.2 μL of Taq polymerase (GoTaq® G2 Flexi DNA polymerase, USA, Reference M7805) with a volume of 5 μL of DNA. PCR amplification conditions of 30 cycles of initial denaturation 94 °C for 5 min, denaturation 94 °C for 1 min, annealing at 50 °C for 1 min (bla-TEM) and 60 °C for 1 min (bla-SHV and bla-CTX-M), elongation 72 °C for 1 min and final elongation for 72 °C for 7 min were carried out in a thermal cycler (GeneAmp® Applied Biosystem). Amplicons were electrophoresed on 1.5% agarose gel containing TAE buffer at 135 V for 30 min (90 mMTris, 90 mM acetate, 2 mM EDTA, pH 8.0) (TAE Buffer, USA) with DNA Ladder 1 kb (Promega, USA). Four bacteria strains were used as positive controls Salmonella spp. (U2A1446) for bla-TEM and bla-SHV, E. coli (U2A1790) for bla-CTX-M group 1, E. coli (U2A1799) for bla-CTX-M group 2 and E. coli (U2A1796) for bla-CTX-M-9 and DNA free reaction mixture as negative controls. Data obtained were entered and analyzed using Excel and GraphPad Prism version 5.01 software. A p-value less than 0.05 was considered to be statistically significant (p < 0.05).
Table 1

Sequences of primers used

Genes

Primers

Sequence (5′–3′)

Weight (pb)

Accession number

blatem

a 216 (+)

ATAAAATTCTTGAAGACGAAA

1079

AB282997

a 217 (−)

GACAGTTACCAATGCTTAATCA

blashv

os-5 (+)

ATTTGTCGCTTCTTTACTCGC

1051

X98098

os-6 (−)

TTTATGGCGTTACCTTTGACC

blactx-M

ctxM1 (+)

GGTTAAAAAATCACTGCGTC

863

X92506

ctxM1 (−)

TTGGTGACGATTTTAGCCGC

ctxM2 (+)

ATGATGACTCAGAGCATTCG

865

X92507

ctxM2 (−)

TGGGTTACGATTTTCGCCGC

ctxM9 (+)

ATGGTGACAAAGAGAGTGCA

869

AF174129

ctxM9 (−)

CCCTTCGGCGATGATTCTC

Results

Phenotypic profile of ESBL producing isolates is shown in Fig. 1. A combination of resistance genes from various bacterial species were observed as shown in Table 2. The occurrence of blaCTX-M gene, blaTEM gene and blaSHV gene in E. coli was 39.6, 24.6 and 3.7% respectively compared to Klebsiella spp. that had 5.9% blaCTX-M gene, 2.7% blaTEM and 1.6% blaSHV gene occurrence. blaTEM-1 gene was found in all 3 health centers whereas CTX-M-9 was detected in bacteria isolated from CHU-YO. blaSHV-1, blaCTX-M-1 and blaCTX-M-2 genes were detected in bacteria isolated from CHU-YO and CHUP-CDG. blaCTX-M-9 gene was detected in Proteus sp. strain isolated from CHU-YO. However, a combination of 3 bla genes were detected in only isolates from CHU-YO and two bla genes were detected in isolates from CHU-YO and CHUP-CDG. Association of ESBL encoding genes with health centers was significant (p = 0.0209).
Fig. 1
Fig. 1

ESBL strains susceptibility to beta-lactam antibiotics. AMX amoxicillin, AMC amoxicillin + clavulanic acid7

Table 2

Distribution of resistance genes blaTEM, blaSHV, blaCTX-M according to the health center

Enterobacteriaceae strains (n/N)

Resistance genes

Yalgado Ouedraogo University Hospital (CHU-YO)

 K. pneumoniae (1/5)

TEM-1

 K. pneumoniae (2/5)

SHV-1

 K. pneumoniae (1/5)

CTX-M-1

 K. pneumoniae (1/5)

CTX-M-2

 K. pneumoniae (1/5)

TEM-1 + CTX-M-1

 K. pneumoniae (1/5)

TEM-1 + CTX-M-2

 K. pneumoniae (1/5)

CTX-M-1 +CTX-M-2

 K. pneumoniae (1/5)

TEM-1 + CTX-M-1 + CTX-M-2

 K. oxytoca (1/1)

SHV-1

 Klebsiella sp. (5/19)

CTX-M-1

 E. coli (4/81)

TEM-1

 E. coli (9/81)

CTX-M-1

 E. coli (9/81)

CTX-M-2

 E. coli (4/81)

TEM-1 + CTX-M-1

 E. coli (4/81)

TEM-1 + CTX-M-2

 E. coli (9/81)

CTX-M-1 + CTX-M-2

 E. coli (4/81)

TEM-1 + CTX-M-1 + CTX-M-2

 Proteus sp. (1/4)

SHV-1

 Proteus sp. (1/4)

CTX-M-9

Pediatric Charles De Gaulle University Hospital (CHUP-CDG)

 E. coli (14/27)

TEM-1

 E. coli (14/27)

CTX-M-1

 E. coli (7/27)

CTX-M-2

 E. coli (7/27)

SHV-1

 E. coli (14/27)

TEM-1 + CTX-M-1

Saint Camille Hospital of Ouagadougou (HOSCO)

 E. coli (2/9)

TEM-1

Discussion

The presence of ESBL-producing bacteria in hospitals poses a serious challenge. This challenge cuts across developed and developing countries. In a multicenter study carried out in 18 representative hospitals in France, it was revealed that ESBL encoding genes including CTX-M-15, CTX-M-1, CTX-M-14 and SHV-12 were most prevalent [19]. Hospitals in Burkina Faso are no exception to this fact. In our study two major Enterobacteriaceae E. coli and Klebsiella spp. bearing various ESBL encoding genes dominated in all three major hospitals in Ouagadougou. This concurs with the findings of Najjuka et al. [20] that reported high prevalence of ESBL-producing E. coli and K. pneumoniae isolated from clinical samples in Uganda. Mathlouthi et al. [21] reported the distribution of blaCTX-M-15 (51.7%), blaTEM-1 (35.6%) and variants of blaSHV (21.8%) in Klebsiella spp. and E. coli stains isolated from hospitals in Tunisia and Libya. This is similar to our findings, however with lower percentage occurrence of bla genes in both E. coli (39.6% blaCTX-M, 24.6% blaTEM, and 3.7% blaSHV) and Klebsiella spp. (5.9% blaCTX-M, 2.7% blaTEM, and 1.6% blaSHV). This does not make the challenge in treatment and management of infection caused by these bacteria in Burkina Faso any lesser. In a similar study in Burkina Faso Ouedraogo et al. [14] reported CTX-M-1 group as dominant followed by CTX-M-9 group, this corroborate our findings with CTX-M-1 and CTX-M-2 dominating in two of the hospitals (CHU-YO and CHUP-CDG). This is in line with the reports of Ibrahim et al., Cantón et al. and Poirel et al. [2224] that, bla-CTX-M genes are the most common types of ESBL in microorganisms in most areas in the world while there seems to have been a drastic decrease of blaSHV. These identified genes play a major role in conferring resistance to extended-spectrum cephalosporins and other β-lactam antibiotics as exemplified in the results of our study. Ninety-three percent (93%) of isolates were resistant to cefepime, 96.8% resistant to cefotaxime, 96.8% resistant to ceftriaxone and 23% resistant to cefoxitine. However no isolate was resistant to imipenem a carbapenem. This corroborates the findings of El bouamri et al. [25] who reported E. coli armed with ESBL encoding genes that were resistant to cefotaxime, ceftazidime, cefepime and other β-lactam antibiotics but none was resistant to imipenem. The significance (p < 0.05) of ESBL encoding genes in strains isolated from health centers implies that hospitals remain a key hub in the potential dissemination of ESBL-producing Enterobacteriaceae. This is in line with the findings of Ahmed et al. [26] that detected bla-SHV and bla-CTX-M genes in Klebsiella pneumoniae isolates from patients with suspected nosocomial infections in Egypt.

Conclusions

The emergence, dissemination and expansion of ESBL- producing Enterobacteriaceae poses a serious public health challenges resulting in substantial limitations in the efficacy of therapeutic interventions. Hence prevention and proactive surveillance of antimicrobial resistance is crucial. Furthermore according to Zahar et al. [27] screening strategies should be established for early identification of patients that are carriers of ESBL producing bacteria in hospitals. Prescription of imipenem should be done with caution and monitored as it remains a viable option in a situation of overwhelming resistance of Enterobacteriaceae to other classes of routinely used antibiotics.

Limitations

This study enrolled patients attending only hospitals located in Ouagadougou Burkina Faso. Future Study should cover other hospitals across the country to determine entire country wise prevalence.

Abbreviations

ESBL: 

extended spectrum beta-lactamase

CHU-YO: 

Yalgado Ouedraogo University Hospital

CHUP-CDG: 

Pediatric Charles De Gaulle University Hospital

HOSCO: 

Saint Camille Hospital of Ouagadougou

Declarations

Authors’ contributions

Conception and design of study: DSK, LS; Sample collection and experiment: DSK, OT, MS, AST; Result analysis and manuscript writing/review: LS, AA, ASO, DSK, NG, MD. All authors read and approved the final manuscript.

Acknowledgements

We acknowledge France Embassy in Burkina Faso; Institut Pasteur de Côte d’Ivoire; National Public Health Laboratory, Burkina Faso; Yalgado Ouedraogo University Hospital, Burkina Faso; Charles De Gaulle Pediatric Hospital, Burkina Faso; Saint Camille Hospital, Burkina Faso.

Competing interests

The authors declare that they have no competing interests.

Availability of data and materials

All data obtained are available within the article.

Consent for publication

Not applicable.

Ethical approval and consent to participate

Ethical approval for this study was obtained from the Central Region Directorate of Health, Ministry of Health Burkina Faso with approval number No. 2014-01632/MS/RCEN/DRSC.

Funding

None.

Publisher’s Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Open AccessThis article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.

Authors’ Affiliations

(1)
Laboratoire des Sciences Appliquées et Nutritionnelles (LabSAN), Centre de Recherche en Sciences Biologiques, Alimentaires et Nutritionnelles (CRSBAN), Université Ouaga 1 Pr Joseph KI-ZERBO, 03 BP 7021, Ouagadougou 03, Burkina Faso
(2)
Laboratoire National de Santé Publique, 09 BP 24, Ouagadougou 09, Burkina Faso
(3)
Centre Hospitalier Universitaire Yalgado Ouedraogo, 03 BP 7022, Ouagadougou 03, Burkina Faso
(4)
Département de Bactériologie et de Virologie, Institut Pasteur de Côte d’Ivoire, 01 BP 490, Abidjan 01, Côte d’Ivoire
(5)
Department of Microbiology, University of Lagos, Akoka, Nigeria
(6)
Unité de Formation et de Recherche en Sciences Appliquées et Technologiques (UFR/SAT)/Institut des Sciences de l’Environnement et du Développement Rural (ISEDR), Centre Universitaire Polytechnique de Dédougou, BP 07, Dédougou, Burkina Faso

References

  1. Rossolini GM, Mantengoli E. Antimicrobial resistance in Europe and its potential impact on empirical therapy. Clin Microbiol Infect. 2008;14:2–8.View ArticlePubMedGoogle Scholar
  2. Pitout JDD, Nordmann P, Laupland KB, Poirel L. Emergence of Enterobacteriaceae producing extended-spectrum β-lactamases (ESBLs) in the community. J Antimicrob Chemother. 2005;56:52–9.View ArticlePubMedGoogle Scholar
  3. Kumar MS, Lakshmi V, Rajagopalan R. Occurrence of extended spectrum beta-lactamases among Enterobacteriaceae spp. isolated at a tertiary care institute. Ind J Med Microbiol. 2006;24:208–11.Google Scholar
  4. Hooper DC. Mechanisms of quinolone resistance. In: Hooper DC, Rubinstein E, editors. Quinolone antimicrobial agents. 3rd ed. Washington, D.C: ASM Press; 2003. p. 41–67.Google Scholar
  5. Robicsek A, Jacoby GA, Hooper DC. The worldwide emergence of plasmid-mediated quinolone resistance. Lancet Infect Dis. 2006;6:629–40.View ArticlePubMedGoogle Scholar
  6. Lin MF, Huangy ML, Laiy SH. Risk factors in the acquisition of extended-spectrum β-lactamase Klebsiella pneumoniae: a case control study in a district teaching hospital in Taiwan. J Hosp Infect. 2003;53:39–45.View ArticlePubMedGoogle Scholar
  7. Liu CP, Weng LC, Tseng HK, Wang NY, Lee CM. Cefotaxime-resistant Citrobacter freundii in isolates from blood in a tertiary teaching hospital in northern Taiwan. J Infect. 2007;55:363–8.View ArticlePubMedGoogle Scholar
  8. Casellas JM, Quinteros MG. A Latin American “point de vue” on the epidemiology, control, and treatment options of infections caused by extended-spectrum beta-lactamase producers. In: Amabile-Cuevas CF, editor. Antimicrobial resistance in bacteria. Wymondham: Horizon Bioscience; 2006.Google Scholar
  9. Bush K, Jacoby GA. Updated functional classification of beta-lactamases. Antimicrob Agents Chemother. 2010;54:969–76.View ArticlePubMedGoogle Scholar
  10. Holstein A, Grillon A, Yzon L, et al. Prevalence of extended-spectrum b-lactamases of the CTX-M type producing Escherichia coli and Klebsiella pneumoniae in Bretonneau hospitals (CHRU tours). Pathol Biol (Paris). 2010;58:67–9.View ArticleGoogle Scholar
  11. Zèba B, Kiendrébeogo M, Lamien A, Docquier JD, Simporé J, Nacoulma OG. Major enzymatic factors involved in bacterial penicillin resistance in Burkina Faso. Pak J Biol Sci. 2007;10:506–10.View ArticlePubMedGoogle Scholar
  12. Mètuor-Dabiré A, Zongo KJ, Zèba B, et al. First detection of shv-type extended spectrum β-lactamases in the University Hospital complex Paediatric Charles De Gaulle (CHUP-CDG) of Ouagadougou in Burkina Faso. J Asian Sci Res. 2014;4:214–21.Google Scholar
  13. Zongo KJ, Mètuor-Dabiré A, Kaboré B, et al. Microbiological and kinetic detection of Gram negative bacilli producing extended-spectrum- β-lactamases (ESBL) in emergencies and reanimation units of University Hospital Center, Yalgado Ouédraogo, Burkina Faso. J Clin Exp Microbiol. 2016;17:116–24.View ArticleGoogle Scholar
  14. Ouedraogo AS, Sanou M, Kissou A, et al. High prevalence of extended-spectrum β-lactamase producing Enterobacteriaceae among clinical isolates in Burkina Faso. BMC Infect Dis. 2016;16:326.View ArticlePubMedPubMed CentralGoogle Scholar
  15. Stadler T, Meinel D, Aguilar-Bultet L, et al. Transmission of ESBL-producing Enterobacteriaceae and their mobile genetic elements. Identification of sources by whole genome sequencing: study protocol for an observational study in Switzerland. BMJ Open. 2018. https://doi.org/10.1136/bmjopen-2018-021823.PubMedPubMed CentralView ArticleGoogle Scholar
  16. Kpoda DS, Guessennd N, Bonkoungou JI, et al. Prevalence and resistance profile of extended-spectrum β-lactamases-producing Enterobacteriaceae in Ouagadougou, Burkina Faso. Afr J Microbiol Res. 2017;11:1120–6.View ArticleGoogle Scholar
  17. Guedda I, Taminiau B, Ferjani A, Boukadida J, Bertrand S, Daube G. Antimicrobial and molecular analysis of Salmonella serovar Livingstone strains isolated from humans in Tunisia and Belgium. J Infect Dev Ctries. 2014;8(8):973–80. https://doi.org/10.3855/jidc.3989.View ArticlePubMedGoogle Scholar
  18. Nunes EL, Dos Santos KR, Mondini PJ, BastosMdo C, Giambiagi-Demarval M. Detection of ilS-2 gene encoding mupirocin resistance in methillin-resistant Staphylococcus aureus by multiplex PCR. Diagn Microbiol Infect Dis. 1999;34:77–81.View ArticlePubMedGoogle Scholar
  19. Robin F, Beyrouthy R, Bonacorsi S, et al. Inventory of extended spectrum-β-lactamase-producing Enterobacteriaceae in France as assessed by a multicenter study. Antimicrob Agents Chemother. 2017;61:e01911–6. https://doi.org/10.1128/AAC.01911-16.View ArticlePubMedPubMed CentralGoogle Scholar
  20. Najjuka CF, Kattete DP, Kajumbula HM, Joloba ML, Essack SY. Antimicrobial susceptibility profiles of Escherichia coli and Klebsiella pneumoniae isolated from outpatients in urban and rural districts of Uganda. BMC Res Notes. 2016;9:235. https://doi.org/10.1186/s13104-016-2049-8.View ArticlePubMedPubMed CentralGoogle Scholar
  21. Mathlonthi N, Al Bayssari C, El Salabi A, et al. Carbapenemases and extended-spectrum β-lactamases producing Enterobacteriaceae isolated from Tunisian and Libyan hospitals. J infect Dev Ctries. 2016;10(7):718–27.View ArticleGoogle Scholar
  22. Ibrahim SA, Ali AE, Ahmady AK. Phenotypic and genotypic identification of extended spectrum beta-lactamases (ESBLs) among clinical isolates of Escherichia coli. Afr J Microbiol Res. 2014;8:1974–81.View ArticleGoogle Scholar
  23. Cantón R, González-Alba JM, Galán JC. CTX-M enzymes: origin and diffusion. Front Microbiol. 2012;2012(3):110.Google Scholar
  24. Poirel L, Bonnin RA, Nordmann P. Genetic support and diversity of acquired extended-spectrum β-lactamases in Gram-negative rods. Infect Genet Evol. 2012;2012(12):883–93.View ArticleGoogle Scholar
  25. El Bouamri MC, Arsalane L, Zerouali K, Katfy K, El Kamouni Y, Zouhair S. Molecular characterization of extended spectrum β-lactamase-producing Escherichia coli in a University hospital in Morocco, North Africa. Afr J Urol. 2015;21:161–6. https://doi.org/10.10161/j.afju.2015.02.005.View ArticleGoogle Scholar
  26. Ahmed OI, El-Hady SA, Ahmed TM, Ahmed IZ. Detection of bla SHV and bla CTX-M genes in ESBL producing Klebsiella pneumoniae isolated from Egyptian patients with suspected nosocomial infections. EJMHG. 2013;14:277–83. https://doi.org/10.1016/j.ejmhg.2013.05.002.View ArticleGoogle Scholar
  27. Zahar JR, Poirel L, Dupont C, Fortineau N, Nassif X, Nordmann P. About the usefulness of contact precautions for carriers of extended spectrum beta-lactamase-producing Escherichia coli. BMC Infect Dis. 2015;15:512. https://doi.org/10.1186/s12879-015-1244-x.View ArticlePubMedPubMed CentralGoogle Scholar

Copyright

© The Author(s) 2018

Advertisement